RuBisCo Stars, Frank Drake and the "Riddle of Life"
December 4, 2009.
One of the great advantages of Scientific Blogging is the immediate feedback that is possible, and even a kind of conversation between reader and author. On November 16, I posted an email from Joe Davis in which he described a remarkable effort to send a message from Earth to three nearby stars and any of their planets that might harbor intelligent life. Joe and I were gratified that his post was read by Seth Shostak, Jill Tarter and Frank Drake, all associated with the SETI Institute in Mountain View, California. We learned a lot from these exchanges, and need to correct some errors that were pointed out. We will do this primarily in the comments at the end of the column, quoting from emails, but will also edit the column itself, noting the corrections in the text. Here are the original first few paragraphs that I wrote, which will be followed by Joe’s revised email and comments.
"Today, November 16, is the 35th anniversary of a coded radar beam that was directed out into the galaxy by Frank Drake, who used the enormous radio telescope dish at Arecibo, Puerto Rico, to send a message from the Earth. (Note: we originally included Carl Sagan, but see the comment by Frank Drake.) Those signals are now 35 light years away. They have already passed the nearest stars, and may even have been intercepted, with a reply heading our way. If that has happened, and we can decipher the incoming message, there will be some very happy people at the SETI Institute in Mountain View, California. Our perception of the human race, living on a small planet circling an ordinary star, alone in the universe, will be changed forever.
Another coded radar signal is now on its way to three nearby stars. It is about one light week out, already beyond the solar system, and the amazing thing is that almost no one knows about it. The only reason I know anything is from a private email sent to a group of friends by Joe Davis. Joe is an artist, living and working in Cambridge, Massachusetts, but instead of paints and canvas, his medium would best be described as artifacts of science and technology, linked and integrated in utterly unique and original ways.
When I read Joe’s note a couple days ago, I immediately knew that this was something worth sharing with readers of Scientific Blogging. Here, with Joe’s permission and a bit of editing, is his email correspondence. "
The coolest iPhone in the world.
Joe Davis
Copyright 2009
In 1974, molecular biology was entering its “golden age”. The hereditary role of DNA was then well known - as were two of the three principal conformations of its molecular structure - but the triplet operation of the genetic code had only recently been unraveled and modern techniques for DNA sequencing were still a few years away. The first genes (DNA) were sequenced in 1977 and the first recombinant organisms were produced in Herbert Boyer’s laboratory at UCSF in 1978. In 1974, there was no genomic science at all. Even though encoded messages of the DNA structure were being transmitted to extraterrestrial intelligence, no one knew that, genetically speaking, human beings are 70% identical to tomatoes.
Wait a minute! Messages transmitted to extraterrestrial intelligence? What does that mean? Well, thirty-five years ago, Frank Drake arranged to have a coded message sent out into the galaxy from the Arecibo Radio Telescope in Puerto Rico. In keeping with molecular biology’s golden age, part of the Drake message was encrypted with a rudimentary likeness of the DNA double helix. (Note: this paragraph corrected by deleting reference to Sagan. See comments.)
Today Arecibo Radar is contributing significant knowledge about the cosmos almost daily. Some of it is "save-the-world" knowledge, like profiling near-Earth asteroids that will one day pose a real threat. They are mapping the lunar surface and subsurface with unrivaled detail, finding heretofore undiscovered pulsars and more.
In the 35 years since the Drake transmission from Arecibo, radar antennae all over the world have more or less routinely searched the sky for unambiguous signals from advanced extraterrestrial civilizations. The SETI-at-Home project, organized by the SETI Institute (Mountain View, CA) has allowed millions of lay enthusiasts to participate in SETI sky surveys by donating processing time on home computers. Various amateur and commercially motivated transmissions have taken place, but such transmissions have been insufficiently powerful and arbitrarily or naively composed by groups and individuals from outside the formal, scientific community. No federal funds at all have been allocated for SETI searches and with the possible exception of Poetica Vaginal (ca. 1986), for almost 35 years, no serious scientific radio messages for extraterrestrial intelligence have been transmitted into space.
Poetic and philosophical implications underlying the scientific search for extraterrestrial intelligence (SETI) have marked much of my work and career as an artist. In the 1980s, technical problems associated with the use of radar and spacecraft as message-transmitters inspired me to develop prototype bacterial carriers of generic information that could survive for very long periods of time in the harsh environments of space. That is how a subject as vast in scope as the search for extraterrestrial intelligence ultimately brought me to the study of molecular biology, and then to Arecibo in November, 2009.
In late October of this year, I contacted members of the astronomy community at Cornell University for referrals to scientists and administrators at Arecibo Observatory (Cornell operates Arecibo Observatory under contract with the National Science Foundation). My objective at Arecibo was to propose the transmission of a new message to extraterrestrial intelligence that would coincide with the 35th anniversary of the famous Drake transmission from Arecibo on 16 November 1974. I also organized recommendations and letters of support for the project from respected members of the international academic and research communities that were sent to Arecibo’s director on my behalf. Among these were recommendations from Dr. Irving Vega of University of Puerto Rico Biology and his Department Chair, Dr. Carmen Maldonado, art historian James Elkins, astronomer and editor, Dr. Roger Malina, CalPoly physics Prof. Peter Scwartz, University of Washington art historian, Marek Wieczorek, scientists from the biology community here in Massachusetts and abroad, members of the astronomy community at Cornell and others.
The RuBisCo Message:
All living things are made of protein and the most abundant protein on Earth is called “RuBisCo” (ribulose- 1,5-bisphosphate carboxylase oxygenase). It is actually quite an interesting protein. To quote Wikipedia, it is “…an enzyme that is used in the Calvin cycle to catalyze the first major step of carbon fixation, a process by which the atoms of atmospheric carbon dioxide are made available to organisms in the form of energy-rich molecules such as sucrose.” It is also interesting in that it actively selects against 13C, one of the naturally occurring stable isotopes of atmospheric carbon, in favor of 12C. The difference of course, is only a single neutron.
In a letter of support sent to Arecibo, Dr. Peter Weigele (staff scientist at New England Biolabs) wrote, "RuBisCo is not only the most abundant protein on earth, it is THE molecule, in all its many forms, that uses the energy supplied by photosynthesis to convert carbon dioxide into food. The choice of this molecule for broadcast communicates the central importance of our sun in sustaining life as well as an implicit understanding of the role of CO2 in our biogeochemical systems. This is a message that is both timely and timeless-- for the Universe and here on Earth!"
The Gene for the large RuBisCo subunit is a 1434-mer DNA molecule:
ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGA
CTTATTATACTCCTGAGTACCAAACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAAC
CTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACT
GTATGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCGCATCGAGCGTGTTGT
TGGAGAAAAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTAC
CAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGA
TCTGCGAATCCCTCCTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGA
TAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAA
AAACTACGGTAGAGCTGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACG
TGAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCAC
AGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGAT
CAAAAGAGCTGTATTTGCTAGAGAATTGGGCGTTCCGATCGTAATGCATGACTACTTAACGGGGGGAT
TCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAA
TGCATGCGGTTATTGATAGACAGAAGAATCATGGTATCCACTTCCGGGTATTAGCAAAAGCGTTACGT
ATGTCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTTGAAGGTGAAAGAGACATAA
CTTTGGGCTTTGTTGATTTACTGCGTGATGATTTTGTTGAACAAGATCGAAGTCGCGGTATTTATTTCAC
TCAAGATTGGGTCTCTTTACCAGGTGTTCTACCCGTGGCTTCAGGAGGTATTCACGTTTGGCATATGCCT
GCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACATCCTTG
GGGTAATGCGCCAGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTAAAAGCTCGTAATGAA
GGACGTGATCTTGCTCAGGAAGGTAATGAAATTATTCGCGAGGCTTGCAAATGGAGCCCGGAACTAG
CTGCTGCTTGTGAAGTATGGAAAGAGATCGTATTTAATTTTGCAGCAGTGGACGTTTTGGATAAGTAA
I was also advised, incidentally, that no special ceremony or event was planned to mark the November 16 anniversary.
I arrived at Arecibo Observatory on Friday, November 6, with several companions who had flown in to participate in the project My companions included Jonathan, Pam and RISD Prof. Emeritus, Al Wunderlich, film maker Peter Sasowsky, photographer and collaborator Ashley Clark and Belgian art historian, Danielle Hofmans. I am now delighted to report that on Saturday night (07 Nov) we managed to send the RuBisCo gene sequence to three "nearby" stars in a way that I will describe below.

Here we are, hanging in the lift that ferried us up to the microwave detectors
located 500 ft above the Arecibo radar dish. Ashley Clark became the
photographer for our trip when we found that cell phones, digital cameras and
video recorders are strictly prohibited in order to avoid RF interference with
sensitive instruments. Serendipitously, Ashley's 8 x 10 film camera was the only
imaging device that we were permitted to use since it contains no batteries or
electronics. Photo: Ashley Clark
But it was a close call, because I had a sort of showdown with Arecibo's interim Director, Dr. Michael C. Nolan at the last minute. His main problem was about politics. Arecibo once received a "Golden Fleece" award from Senator Proxmire for its involvement with the search for extraterrestrial intelligence, including its role in the Drake transmission of 1974. There are some very serious concerns about future funding for the observatory. Nolan argued that 35 years ago, the efforts of Frank Drake were carried out in a way that made “no sense”. I explained that projects concerned with the search for extraterrestrial intelligence are really more about a search for ourselves; that they make us look much more intensely at ourselves than we look away into space and that nobody seems to see that part of it. I wanted to make clear to him that this was not really a project about "aliens". Nolan countered that "Now you're being too rational." He seemed amused because I think he actually understood what I was trying to tell him, but his concern was that of the operator of a federally funded organization. He knows that he can't sell ideas like these to politicians and university funding officers. He complained about the Byzantine ins and outs of funding both at federal and university levels. He said he was afraid of doing "marginal" things because he felt that projects like mine might ultimately get in the way of "serious" science. In spite of these concerns, Nolan added, something like, "We're still negotiating. I still want to do this."
I pointed out that SETI in general addresses fundamental questions like "Is this who we are?" and "Is this what we know?" I asked him point blank if Arecibo was actually ashamed of the Drake SETI message. Nolan answered that Drake's scientific reputation has indeed been called into question (I don't know why). (Note: We removed a reference to Sagan here.) At one point, Nolan proposed that I enter into collaboration with local amateur (ham) radio operators (which involves the use of Arecibo Radar to bounce radio signals off the moon) because, he said, "I'm licensed to take pictures of asteroids, not to do things like this."
Almost as a last line of defense, I was advised of Arecibo's disabled "coder". I knew that I had to solve this problem at once or the allotted time on Arecibo Radar would run out. I would miss the opportunity to transmit signals on the 35th anniversary and perhaps, miss the opportunity altogether. I pulled out my laptop and brought up pictures of the band-pass filter and gate that I used to get analog signals interfaced with Millstone radar 25 years ago. Nolan acknowledged that something like that might be possible at Arecibo, but he still seemed to be backpedaling. He asked how fast I could get that apparatus to Puerto Rico, knowing full well that even if I had it air-freighted from Cambridge, there would be no way it would arrive before my access to the radar would end on Monday (09 Nov). He suggested that I should consider putting off the whole project until some indefinite future date.
I realized that whatever options remained, they would have to be produced immediately with no time even to go away and fabricate something in say, a local machine shop (which of course, would be closed on the following day, a Sunday). I started thinking about what I had in my bags and in my pockets. I had my iPhone (eureka!). I also had a funky television connector inadvertently left in my computer bag from some earlier episode of trash mining in Cambridge and as it turned out, that connector to be a crucial component needed to connect my iPhone to the radar. I proposed creating a sound file from the RuBisCo sequence that could then be recorded on my iPhone and interfaced with the radar. At that point, a surprised and still amused Michael Nolan relented.
But there was one last problem: How could the gene be sent out as a coded signal? One way would be to prepare a binary map by assigning numerical values to DNA nucleotides based on molecular weight where C=00 T=01 A=10 and G=11. The result is a 2868-bit binary sequence that is less than twice as large as the 1679-bit Drake CETI message. Like the Drake message, a transmission containing the RuBisCo sequence could be transmitted in a very brief period of time owing to its relatively small size:
100111010010000010001010100010111011100001101010110010101101110101111110010
100101010110001111101110101101010111011011000101010010111100001011001011001
100001000001111011011000001010100000101011111001100001111001100110010111110
010110010010100001110110110100001000001001010000001111110110101000010000001
111010111010110010111111110000110011110110110001110000111010010001010001100
001111101100010011111100010100001110110011111100000111001111110000101100000
101100000101111001001101011000101010111111001110011100011000001100100100111
011001101110101110101111110111010101010111001001010011001100101110001011001
110110110001011000000001010110111000000101010101111010111010111101010001110
101100000101000100111010101100001010000100101110110111101101000110110010101
111111010100101010110000000111001100110001000110001101000111111010111001000
111001110100100000001000001110001011001110101101010100001010100001010111101
000011000001001001111111100100001010110101111010101110111001101010010111101
000101011011001111101001101000000000111010111111110011101100001100101101010
000001101010010111111111010110010001110001101010101000011000111101101110110
001110101011001111010011101000101001100111101111110000101111001010101100000
101010111001111001111011101000110111101000010010001010000010010101100111001
101011111101110111001001101010100010110010101011101110000111010110010000101
011001101010110010001011110001111010100010111101111010100100101010111111001
001011000010111101001110001100001110010111101100010011100111010111010100111
100100101010101110110001110110010101110001101110111010010111111100110101000
011100100110110100111001001111000011000010110100011111111111110010100100000
110010101001100001101100010111110001001001011001011100001110111001101001111
101000110000101000101001000100100001000001101110010100111001001110011110101
100101111001101110001011101011101001001001111101100100001000010100001111110
110010110110010101010110011010110001101100111010001111101111110111001001001
100101001000010001111101100000110110110110111101101010000101111010111101111
010101110111000100110100001010111111100010101110101111001010110000111001101
111001111001010101110101111010001010111001001110101101001100111101100101011
001010100100001001010111001011111110100010001010110000010111101110101000110
000000110111110001010010111110111101100101001000110101011111001001100111000
001110001000111100000111011100100010101111111111001111001010000110110000110
001011010100111101111110111110100001010110111110001001000001011111111101101
001110011000010111101110000110110110001101001001110110110110001000110111010
110010011101110110101010110001001101101001111010111110001101111001000101110
001001011111010111101101001111010100101100101001100111011110001011100101010
011111101100000011111010000110110001110001110001011101111010110110011111101
010111011100100110110010101101001010101110010110010110111111000110101010111
11100110101101101
However, the gene encoded in binary lacks punctuation. This meant that anyone receiving the signal would need to guess that four bases were being encoded as paired binary bits: 00, 01, 10 and 11, otherwise it would just be a meaningless jumble. So instead, I decided to create sound files with spoken syllables where "space-one syllable-space" = C and so on to "space-four syllables-space"=G
This strategy also allowed me to interpose another layer of meaning in the message. The syllables were:
C) space - "I" - space
T) space - "amthe" - space
A) space - "knowyourself" - space
G) space - "riddleoflife" - space
These coded phrases can be arranged into the edict of Apollo that is inscribed at the entrance to the temple at Delphi where it says, "Know yourself and you will know all of the secrets of the universe and the secrets of the gods". I think Arecibo Observatory is somehow analogous to the temple at Delphi. Astronomers at Arecibo routinely glean the heavens to uncover such secrets. Do a little algebra and it's obvious that they must also be learning something about ourselves.
We used AppleSpeak to vocalize the phonetic code which I then recorded on my iPhone. Here is the total message, which can be decoded unambiguously into the gene for RuBisCo:
knowyourself amthe riddleoflife amthe I knowyourself I I knowyourself I knowyourself knowyourself knowyourself I knowyourself riddleoflife knowyourself riddleoflife knowyourself I amthe knowyourself knowyourself knowyourself riddleoflife I knowyourself knowyourself riddleoflife amthe riddleoflife amthe amthe riddleoflife riddleoflife knowyourself amthe amthe I knowyourself knowyourself knowyourself riddleoflife I amthe riddleoflife riddleoflife amthe riddleoflife amthe amthe knowyourself knowyourself knowyourself riddleoflife knowyourself riddleoflife amthe knowyourself I knowyourself knowyourself knowyourself amthe amthe riddleoflife knowyourself I amthe amthe knowyourself amthe amthe knowyourself amthe knowyourself I amthe I I amthe riddleoflife knowyourself riddleoflife amthe knowyourself I I knowyourself knowyourself knowyourself I I knowyourself knowyourself riddleoflife riddleoflife knowyourself amthe knowyourself I amthe riddleoflife knowyourself amthe knowyourself amthe knowyourself amthe amthe riddleoflife riddleoflife I knowyourself riddleoflife I knowyourself amthe amthe I I riddleoflife knowyourself riddleoflife amthe knowyourself knowyourself I amthe I I amthe I knowyourself knowyourself I I amthe riddleoflife riddleoflife knowyourself riddleoflife amthe amthe I I knowyourself I I amthe riddleoflife knowyourself knowyourself riddleoflife knowyourself knowyourself riddleoflife I knowyourself riddleoflife riddleoflife riddleoflife riddleoflife I I riddleoflife I riddleoflife riddleoflife amthe knowyourself riddleoflife I amthe riddleoflife I I riddleoflife knowyourself knowyourself amthe I amthe amthe I amthe knowyourself I amthe riddleoflife riddleoflife amthe knowyourself I knowyourself amthe riddleoflife riddleoflife knowyourself I knowyourself knowyourself I amthe riddleoflife amthe knowyourself amthe riddleoflife riddleoflife knowyourself I I riddleoflife knowyourself amthe riddleoflife riddleoflife knowyourself I amthe amthe knowyourself I I knowyourself riddleoflife I I amthe amthe riddleoflife knowyourself amthe I riddleoflife amthe amthe knowyourself I knowyourself knowyourself knowyourself riddleoflife riddleoflife riddleoflife I riddleoflife knowyourself amthe riddleoflife I amthe knowyourself I I riddleoflife I knowyourself amthe I riddleoflife knowyourself riddleoflife I riddleoflife amthe riddleoflife amthe amthe riddleoflife amthe amthe riddleoflife riddleoflife knowyourself riddleoflife knowyourself knowyourself knowyourself knowyourself knowyourself riddleoflife knowyourself amthe I knowyourself knowyourself amthe knowyourself amthe knowyourself amthe amthe riddleoflife I amthe amthe knowyourself amthe riddleoflife amthe knowyourself riddleoflife I amthe amthe knowyourself I I I amthe amthe amthe knowyourself riddleoflife knowyourself I I amthe amthe amthe amthe amthe riddleoflife knowyourself knowyourself riddleoflife knowyourself knowyourself riddleoflife riddleoflife amthe amthe I amthe riddleoflife amthe amthe knowyourself I I knowyourself knowyourself I knowyourself amthe riddleoflife amthe amthe amthe knowyourself I amthe amthe I I knowyourself amthe amthe riddleoflife amthe knowyourself riddleoflife riddleoflife amthe knowyourself knowyourself I riddleoflife amthe knowyourself amthe amthe amthe riddleoflife riddleoflife riddleoflife amthe amthe I knowyourself knowyourself knowyourself riddleoflife I I I amthe riddleoflife I riddleoflife I riddleoflife I amthe I amthe knowyourself I riddleoflife amthe I amthe riddleoflife riddleoflife knowyourself knowyourself riddleoflife knowyourself amthe I amthe riddleoflife I riddleoflife knowyourself knowyourself amthe I I I amthe I I amthe riddleoflife I amthe amthe knowyourself amthe riddleoflife amthe amthe knowyourself knowyourself knowyourself knowyourself I amthe amthe amthe I I knowyourself knowyourself riddleoflife riddleoflife amthe I I riddleoflife I I amthe I knowyourself amthe riddleoflife riddleoflife riddleoflife knowyourself amthe I I knowyourself knowyourself riddleoflife amthe amthe riddleoflife knowyourself knowyourself knowyourself riddleoflife knowyourself riddleoflife knowyourself amthe knowyourself knowyourself knowyourself amthe amthe riddleoflife knowyourself knowyourself I knowyourself knowyourself riddleoflife amthe knowyourself amthe riddleoflife riddleoflife amthe I riddleoflife amthe I I I I amthe riddleoflife amthe amthe riddleoflife riddleoflife riddleoflife knowyourself amthe riddleoflife amthe knowyourself I amthe knowyourself amthe amthe knowyourself knowyourself knowyourself I I amthe knowyourself knowyourself knowyourself amthe amthe riddleoflife riddleoflife riddleoflife riddleoflife amthe amthe knowyourself amthe I amthe riddleoflife I amthe knowyourself knowyourself knowyourself knowyourself knowyourself I amthe knowyourself I riddleoflife riddleoflife amthe knowyourself riddleoflife knowyourself riddleoflife I amthe riddleoflife amthe amthe amthe knowyourself amthe riddleoflife knowyourself knowyourself amthe riddleoflife amthe I amthe amthe I riddleoflife I riddleoflife riddleoflife amthe riddleoflife riddleoflife knowyourself I amthe amthe riddleoflife knowyourself amthe amthe amthe amthe knowyourself I I knowyourself knowyourself knowyourself riddleoflife knowyourself amthe riddleoflife knowyourself amthe riddleoflife knowyourself riddleoflife knowyourself knowyourself I riddleoflife amthe riddleoflife knowyourself knowyourself I amthe I knowyourself I knowyourself knowyourself I I knowyourself amthe amthe amthe knowyourself amthe riddleoflife I riddleoflife amthe amthe riddleoflife riddleoflife knowyourself riddleoflife knowyourself riddleoflife knowyourself amthe I riddleoflife amthe amthe amthe I amthe amthe knowyourself amthe amthe amthe amthe riddleoflife amthe riddleoflife I I riddleoflife knowyourself knowyourself riddleoflife I knowyourself I amthe amthe amthe knowyourself amthe knowyourself knowyourself knowyourself riddleoflife I knowyourself I knowyourself riddleoflife riddleoflife I amthe riddleoflife knowyourself knowyourself knowyourself I knowyourself riddleoflife riddleoflife amthe riddleoflife knowyourself knowyourself knowyourself amthe I knowyourself knowyourself knowyourself riddleoflife riddleoflife riddleoflife I knowyourself amthe amthe knowyourself I amthe amthe riddleoflife knowyourself knowyourself amthe riddleoflife I amthe knowyourself I amthe riddleoflife I knowyourself riddleoflife riddleoflife amthe knowyourself I knowyourself amthe riddleoflife I riddleoflife knowyourself knowyourself riddleoflife knowyourself knowyourself knowyourself amthe riddleoflife knowyourself amthe I knowyourself knowyourself knowyourself knowyourself riddleoflife knowyourself riddleoflife I amthe riddleoflife amthe knowyourself amthe amthe amthe riddleoflife I amthe knowyourself riddleoflife knowyourself riddleoflife knowyourself knowyourself amthe amthe riddleoflife riddleoflife riddleoflife I riddleoflife amthe amthe I I riddleoflife knowyourself amthe I riddleoflife amthe knowyourself knowyourself amthe riddleoflife I knowyourself amthe riddleoflife knowyourself I amthe knowyourself I amthe amthe knowyourself knowyourself I riddleoflife riddleoflife riddleoflife riddleoflife riddleoflife riddleoflife knowyourself amthe amthe I knowyourself I I riddleoflife I knowyourself knowyourself knowyourself amthe knowyourself I amthe knowyourself riddleoflife I amthe amthe riddleoflife riddleoflife I amthe I knowyourself amthe amthe knowyourself amthe amthe riddleoflife I I riddleoflife knowyourself riddleoflife knowyourself amthe knowyourself knowyourself amthe riddleoflife riddleoflife amthe I amthe knowyourself I amthe amthe I amthe amthe I knowyourself I knowyourself amthe I I knowyourself I I riddleoflife amthe riddleoflife I knowyourself knowyourself amthe riddleoflife I knowyourself amthe riddleoflife I riddleoflife riddleoflife amthe amthe knowyourself amthe amthe riddleoflife knowyourself amthe knowyourself riddleoflife knowyourself I knowyourself riddleoflife knowyourself knowyourself riddleoflife knowyourself knowyourself amthe I knowyourself amthe riddleoflife riddleoflife amthe knowyourself amthe I I knowyourself I amthe amthe I I riddleoflife riddleoflife riddleoflife amthe knowyourself amthe amthe knowyourself riddleoflife I knowyourself knowyourself knowyourself knowyourself riddleoflife I riddleoflife amthe amthe knowyourself I riddleoflife amthe knowyourself amthe riddleoflife amthe I amthe riddleoflife riddleoflife amthe riddleoflife riddleoflife knowyourself riddleoflife knowyourself amthe I knowyourself amthe knowyourself amthe amthe I knowyourself I amthe I amthe riddleoflife riddleoflife amthe knowyourself I I riddleoflife amthe knowyourself riddleoflife amthe knowyourself riddleoflife riddleoflife amthe knowyourself knowyourself knowyourself I amthe amthe riddleoflife knowyourself knowyourself riddleoflife riddleoflife amthe riddleoflife knowyourself knowyourself knowyourself riddleoflife knowyourself riddleoflife knowyourself I knowyourself amthe knowyourself knowyourself I amthe amthe amthe riddleoflife riddleoflife riddleoflife I amthe amthe amthe riddleoflife amthe amthe riddleoflife knowyourself amthe amthe amthe knowyourself I amthe riddleoflife I riddleoflife amthe riddleoflife knowyourself amthe riddleoflife knowyourself amthe amthe amthe amthe riddleoflife amthe amthe riddleoflife knowyourself knowyourself I knowyourself knowyourself riddleoflife knowyourself amthe I riddleoflife knowyourself knowyourself riddleoflife amthe I riddleoflife I riddleoflife riddleoflife amthe knowyourself amthe amthe amthe knowyourself amthe amthe amthe I knowyourself I amthe I knowyourself knowyourself riddleoflife knowyourself amthe amthe riddleoflife riddleoflife riddleoflife amthe I amthe I amthe amthe amthe knowyourself I I knowyourself riddleoflife riddleoflife amthe riddleoflife amthe amthe I amthe knowyourself I I I riddleoflife amthe riddleoflife riddleoflife I amthe amthe I knowyourself riddleoflife riddleoflife knowyourself riddleoflife riddleoflife amthe knowyourself amthe amthe I knowyourself I riddleoflife amthe amthe amthe riddleoflife riddleoflife I knowyourself amthe knowyourself amthe riddleoflife I I amthe riddleoflife I amthe I amthe riddleoflife knowyourself I I riddleoflife knowyourself riddleoflife knowyourself amthe I amthe amthe amthe riddleoflife riddleoflife riddleoflife riddleoflife knowyourself amthe riddleoflife knowyourself amthe amthe I I riddleoflife amthe knowyourself I amthe knowyourself I knowyourself riddleoflife amthe amthe I riddleoflife riddleoflife amthe riddleoflife riddleoflife knowyourself riddleoflife riddleoflife knowyourself knowyourself I amthe amthe amthe knowyourself riddleoflife riddleoflife knowyourself I knowyourself amthe I I amthe amthe riddleoflife riddleoflife riddleoflife riddleoflife amthe knowyourself knowyourself amthe riddleoflife I riddleoflife I I knowyourself riddleoflife riddleoflife amthe riddleoflife I I riddleoflife amthe knowyourself riddleoflife I amthe knowyourself knowyourself amthe I riddleoflife knowyourself riddleoflife amthe knowyourself riddleoflife I amthe I amthe knowyourself riddleoflife knowyourself knowyourself riddleoflife I knowyourself amthe riddleoflife amthe riddleoflife amthe knowyourself knowyourself knowyourself knowyourself riddleoflife I amthe I riddleoflife amthe knowyourself knowyourself amthe riddleoflife knowyourself knowyourself riddleoflife riddleoflife knowyourself I riddleoflife amthe riddleoflife knowyourself amthe I amthe amthe riddleoflife I amthe I knowyourself riddleoflife riddleoflife knowyourself knowyourself riddleoflife riddleoflife amthe knowyourself knowyourself amthe riddleoflife knowyourself knowyourself knowyourself amthe amthe knowyourself amthe amthe I riddleoflife I riddleoflife knowyourself riddleoflife riddleoflife I amthe amthe riddleoflife I knowyourself knowyourself knowyourself amthe riddleoflife riddleoflife knowyourself riddleoflife I I I riddleoflife riddleoflife knowyourself knowyourself I amthe knowyourself riddleoflife I amthe riddleoflife I amthe riddleoflife I amthe amthe riddleoflife amthe riddleoflife knowyourself knowyourself riddleoflife amthe knowyourself amthe riddleoflife riddleoflife knowyourself knowyourself knowyourself riddleoflife knowyourself riddleoflife knowyourself amthe I riddleoflife amthe knowyourself amthe amthe amthe knowyourself knowyourself amthe amthe amthe amthe riddleoflife I knowyourself riddleoflife I knowyourself riddleoflife amthe riddleoflife riddleoflife knowyourself I riddleoflife amthe amthe amthe amthe riddleoflife riddleoflife knowyourself amthe knowyourself knowyourself riddleoflife amthe knowyourself knowyourself
The Wunderlichs, Ashley Clark, Danielle Hofmans and I spent the next couple of hours creating sound files and hacking the connections with the iPhone, assorted cables and alligator clips. While setting up the iPhone connections, we conducted a test transmission using the song, "Run Come See Jerusalem" by Bahamian musician and vocalist, Andrew Jones. At the moment we hooked up the iPhone to the radar, the energy and excitement in the Arecibo control room was literally palpable. Everyone, including Arecibo staff and visiting scientists seemed to be infected by the effort. Then, we interfaced my iPhone with Arecibo's powerful radar and transmitted from approximately 11:30 p.m. until 12:45 a.m. The duration of each transmission was approximately 5 times longer than the 1974 Drake transmission. We spent the next hour and a half transmitting messages to the following three stars:
1st star: GJ 83.1 (sent at 23:38:45)
2nd star: Teagarden’s star SO 025300.5+165258
3rd star: kappa ceti (G5B).
It worked! Now I have the coolest iPhone in the world.

Joe Davis and the coolest iPhone in the world. Photo Credit: Ashley Clark
On Sunday, I was invited to help prepare an extremely sensitive set of microwave detectors for experiments scheduled for Monday to search for pulsars. The detectors happen to be located 500 ft above the Arecibo radar dish suspended in a steel truss platform. Ashley and Danielle and I all went up there early in the afternoon. There was a sudden torrential downpour while we were still “hanging out” on the truss. I have to say it was one of the scariest, most exciting moments I've had in the past several years. I loved it.
I delivered a talk on at 11:00 a.m. on Monday 09 Nov. for Arecibo staff and scientists. I think there was visible skepticism on the faces of my audience when they walked into the room and visible excitement when they left. At lunch Michael Nolan and I talked about coauthoring a journal article. We are also grateful to Arecibo Observatory for making accommodations available to us through the several days in which we pursued the project.
I'd like to say I've had enough adventures for one week, but it's not really true. Now I will have to balance books. I applied for two small grants to help me do this. Both were denied. I was not funded by MIT, the government, or anyone else to carry out this project. It has been expensive, at least, from my point of view. I do have the coolest iPhone now, so how can I complain? Who knows who might be calling back?
Epilog
On Thursday evening I learned that NATURE assigned the "rubisco stars" story to science writer Steve Nadis provided he could guarantee that ARECIBO has not been used to send an "active SETI" message since 1974, which of course, is actually the case.
Then, according to Steve Nadis, Arecibo Director Mike Nolan told him there wasn't any way he could write the story so that it could not potentially hurt him or Arecibo. So Nadis has put it on hold indefinitely...
Funny, isn't it? Aristotle knew that you have to reveal yourself to yourself before you can reveal yourself to anyone else (theory of tragedy in Poetics). Why is it that most serious efforts to send messages to extraterrestrials become mired in episodes of censorship?




Comments